10 × colorless extaq buffer ® (Promega)
90
Structured Review
Promega
10 × colorless extaq buffer ®
10 × Colorless Extaq Buffer ®, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/10+%C3%97+colorless+extaq+buffer+%C2%AE/10+%C3%97+colorless+extaq+buffer++/pmc06443722-114-33-51
Average 90 stars, based on 1 article reviews
10 × Colorless Extaq Buffer ®, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/10+%C3%97+colorless+extaq+buffer+%C2%AE/10+%C3%97+colorless+extaq+buffer++/pmc06443722-114-33-51
Average 90 stars, based on 1 article reviews
10 × colorless extaq buffer ® - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
other:Article Title: Nutrient Exchange of Carbon and Nitrogen Promotes the Formation of Stable Mutualisms Between Chlorella sorokiniana and Saccharomyces cerevisiae Under Engineered Synthetic Growth Conditions Article Snippet: PCR reactions (50 μl) contained 50 ng of yeast genomic DNA (KW 4 or KW 13), 0.5 μM ITS1 primer (5′TCCGTAGGTGAACCTGCGG 3′), 0.5 μM ITS4 primer (5′ TCCTCCGCTTATTGATATGC 3′),1 × buffer (10 × colorless ExTaq Buffer ® ), 0.25 mM dNTPs, 2 mM MgCl 2 , and 1.25 U |